Casquete 5' y cola de poli-A. Empalme, intrones y exones.

Puntos más importantes:

  • Cuando se produce inicialmente un transcrito de ARN en una célula eucarionte, se considera un pre-ARNm y se debe procesar para obtener un ARN mensajero (ARNm).
  • Al inicio del transcrito de ARN se añade un cap 5' y al final, una cola de poli-A en 3'.
  • En el empalme, algunas secciones del transcrito de ARN (intrones) se eliminan y las secciones restantes (exones) se vuelven a unir.
  • Algunos genes pueden experimentar empalme alternativo, lo que conduce a la producción de diferentes ARNm maduros a partir del mismo transcrito inicial.

Introducción

Imagina que estás a cargo de una fábrica de libros y acabas de imprimir todas las páginas de tu libro favorito. Ya que tenemos las páginas, ¿el libro estaría completamente listo? Pues... los libros generalmente tienen cubierta y contraportada; tal vez se las quieras agregar. Además, ¿no habrán quedado páginas en blanco o en desorden durante la impresión? Sería bueno revisar eso y quitar esas páginas antes de vender tus libros, o podrías terminar con algunos clientes descontentos.
Los pasos que acabamos de comentar son bastante similares a lo que ocurre con los transcritos de ARN en las células de tu cuerpo. En seres humanos y otros eucariontes, un transcrito de ARN recién hecho (apenas salido de la "prensa" que es la ARN polimerasa) todavía no está listo realmente. En realidad, esta molécula se llama pre-ARNm y tiene que pasar por algunos pasos de procesamiento para convertirse en un ARN mensajero (ARNm) maduro que puede ser traducido en una proteína. Estos pasos incluyen:
  • La adición de las moléculas cap y cola a los dos extremos del transcrito. Estas desempeñan un papel protector, como la cubierta y la contraportada de un libro.
  • La eliminación de secuencias de "basura" llamadas intrones. Los intrones son algo así como páginas en blanco o sin sentido que se hacen durante la impresión de un libro y deben ser eliminadas para que el libro sea legible.
En este artículo, revisaremos de cerca el cap, la cola y las modificaciones de empalme que experimentan los transcritos eucariontes de ARN, veremos cómo se realizan y por qué son importantes para asegurar que obtenemos la proteína correcta de nuestro ARN.

Resumen sobre el procesamiento del pre-mRNA en eucariontes

Como un rápido repaso, la expresión génica (la "lectura" de un gen para producir una proteína o un pedazo de proteína) ocurre de forma un poco diferente entre bacterias y eucariontes como los seres humanos.
Panel de la izquierda: célula eucarionte. En el núcleo, la transcripción de una región de ADN de un cromosoma lineal produce un pre-ARNm. Este transcrito debe someterse a procesamiento (empalme y adición de cap 5' y cola de poli-A) mientras está en el núcleo para convertirse en un ARNm maduro. El ARNm maduro se exporta del núcleo al citosol, donde se traduce en un ribosoma para generar un polipéptido.
Panel de la derecha: bacteria. El ADN se encuentra en forma de un cromosoma circular y se encuentra en el citosol. Mientras se transcribe el ADN para producir un ARN, el ARN (que ya se considera un ARNm en este punto) puede unirse a un ribosoma y comenzar a traducirse para generar un polipéptido.
En bacterias, los transcritos de ARN están listos para desempeñarse como ARN mensajeros y se traducen en proteínas inmediatamente. En eucariontes, las cosas son un poco más complejas, aunque de una manera bastante interesante. La molécula que produce la transcripción directamente en una de tus células (eucariontes) se llama pre-ARNm, lo que refleja que tiene que que pasar por algunos pasos más para convertirse en un ARN mensajero (ARNm) real. Estos son:
  • Añadir un cap 5' al inicio del ARN
  • Añadir una cola de poli-A (cola de nucleótidos A) al final del ARN
  • Cortar y quitar los intrones, o secuencias "basura", y pegar las secuencias restantes, las buenas (exones)
Una vez que se han completado estos pasos, el ARN es un ARNm maduro. Este puede viajar fuera del núcleo y ser utilizado para hacer una proteína.

El cap 5' y la cola de poli-A

Ambos extremos de un pre-ARNm se modifican con la adición de grupos químicos. El grupo del inicio (extremo 5') se llama cap y el grupo del final (extremo 3') se llama cola. El cap y la cola protegen el transcrito, ayudan a que sea exportado del núcleo y traducido en los ribosomas (las "máquinas" que fabrican proteínas) que se encuentran en el citosol1^1.
El cap 5' se agrega al primer nucleótido del transcrito durante la transcripción. El cap es un nucleótido modificado de guanina (G) que protege al transcrito de la degradación. También ayuda al ribosoma a unirse al ARNm y a comenzar a leerlo para hacer una proteína.
Imagen de un pre-ARNm con un cap 5' y una cola de poli-A. El cap 5' se encuentra en el extremo 5' del pre-ARNm y es un nucleótido de G modificado. La cola de poli-A se encuenra en el extremo 3' del pre-mRNA y se compone de una larga cadena de nucleótidos de A (de los cuales solo se muestran unos cuantos).
¿Cómo se añade la cola poly-A? El extremo 3' del ARN se forma de una manera un poco extraña. Cuando durante la transcripción aparece una secuencia llamada señal de poliadenilación en la molécula del ARN , una enzima corta el ARN en dos en ese sitio. Otra enzima añade de 100100 200200 nucleótidos de adenina (A) en el extremo cortado para formar una cola de poli-A. La cola le brinda al transcrito mayor estabilidad y lo ayuda a ser exportado del núcleo hacia el citosol.

Empalme de ARN

El tercer evento más importante en el procesamiento del ARN que sucede en tus células se conoce como empalme de ARN. En el empalme de ARN, ciertas regiones del transcrito del pre-ARNm, conocidas como intrones, son reconocidas y eliminandas por un complejo enzimático especializado llamado espliceosoma. Los intrones pueden considerarse secuencias "basura" que se deben cortar para que se pueda conformar la "versión con las partes buenas" de la molécula de ARN.
¿Cuáles son las "partes buenas"? Los fragmentos de ARN que no se eliminan se llaman exones. El espliceosoma pega los exones para generar el ARNm final y maduro, el cual se envía fuera del núcleo.
Diagrama de un pre-ARNm en el que se indican exones e intrones. A lo largo de la cadena del ARNm, hay un patrón alternante de exones e intrones: exón 1 - intrón 1 - exón 2 - intrón 2 - exón 3. Cada uno consta de un segmento de nucleótidos de ARN. Durante el empalme, los intrones se retiran del pre-ARNm y los exones se vuelven a pegar para formar un ARNm maduro que no contiene las secuencias de intrones.
Un punto clave aquí es que es solo los exones de un gen codifican proteína. Los intrones no solo carecen de información para construir una proteína, en realidad tienen que ser eliminados para el ARNm codifique una proteína con la secuencia correcta. Si el espliceosoma no quita un intrón, se obtendrá un ARNm con "basura" extra y se producirá una proteína errónea durante la traducción.
El empalme debe ser preciso y uniforme. Este cuidadoso cortado y pegado se realiza en el espliceosoma, un complejo enzimático formado por proteínas y ARN pequeños. La mayoría de los intrones contienen secuencias señal en ambos de sus extremos, las cuales son reconocidas por ARN pequeños y dirigen el espliceosoma en el corte del intrón. Una vez que se ha cortado el intrón, el espliceosoma "pegará" (ligará) los exones que flanqueaban dicho intrón.

Empalme alternativo

¿De qué sirve el empalme? No sabemos realmente por qué existe el empalme y, de cierta forma, parece un sistema derrochador. Sin embargo, el empalme posibilita un proceso llamado empalme alternativo, en que puede hacerse más de un ARNm del mismo gen. Mediante el empalme alternativo, los humanos (y otros eucariontes) podemos codificar secretamente un número mayor de proteínas que los genes que tenemos en nuestro ADN.
En el empalme alternativo, un pre-ARNm se puede empalmar en cualquiera de dos (¡a veces muchas más que dos!) maneras diferentes. Por ejemplo, en el siguiente diagrama, el mismo pre-ARNm puede empalmarse de tres maneras diferentes, según los exones que se conservan. Esto resulta en tres ARNm maduros diferentes que se traducen en proteínas con estructuras diferentes.
Diagrama de empalme alternativo.
Una secuencia de ADN codifica un transcrito de pre-ARNm que contiene cinco regiones y potencialmente todas pueden utilizarse como exones: exón 1, exón 2, exón 3, exón 4 y exón 5. Los exones se disponen en orden lineal a lo largo del pre-ARNm y tienen intrones entre ellos.
En el primer caso de empalme se conservan los cinco exones en el ARNm maduro. Este se compone de: exón 1 - exón 2 - exón 3 - exón 4 - exón 5. Cuando se traduce el transcrito, se especifica la proteína A, una proteína con cinco dominios: hélice 1 (codificada por el exón 1), hélice 2 (codificada por el exón 2), listón 3 (codificado por el exón 3), listón 4 (codificado por el exón 4) y hélice 5 (codificada por el exón 5).
En el segundo caso de empalme no se incluye el exón 3 en el ARNm maduro. Este se compone de: exón 1 - exón 2 - exón 4 - exón 5. Cuando se traduce el transcrito, se especifica la proteína B, una proteína con cuatro dominios: hélice 1 (codificada por el exón 1), hélice 2 (codificada por el exón 2), listón 4 (codificado por el exón 4) y hélice 5 (codificada por el exón 5). No contiene el listón 3 porque el exón 3 no se encuentra en el ARNm.
En el tercer caso de empalme no se incluye el exón 4 en el ARNm maduro. Este se compone de: exón 1 - exón 2 - exón 3 - exón 5. Cuando es traducido, se especifica la proteína C, una proteína con cuatro dominios: hélice 1 (codificada por el exón 1), hélice 2 (codificada por el exón 2), listón 3 (codificado por el exón 3) y hélice 5 (codificada por el exón 5). No contiene el listón 4 porque el exón 4 no se encuentra en el ARNm.
_Crédito de la imagen: "DNA, alternative splicing", por el National Human Genome Research Institute (dominio público)._
¡Muy buena pregunta! Los biólogos profesionales también quisieran saber la respuesta. No está totalmente claro por qué los intrones y el empalme están tan generalizados en los eucariontes.
Una posibilidad es que el empalme en general permite el empalme alternativo, que parece ser importante para los eucariontes (porque les permite producir una mayor diversidad de proteínas a partir de un solo gen). También, los intrones suelen contiener secuencias reguladoras que controlan la expresión de un gen (no son realmente "basura)2^2. A veces, los ARN pequeños que regulan la expresión génica provienen de intrones que se descartan durante el empalme3^3. Además, la existencia de exones e intrones puede facilitar la aparición de nuevos genes y alelos mediante eventos de mutación que mezclan y combinan segmentos génicos, lo cual podría tener ventajas evolutivas2,4^{2,4}.

Inténtalo tú mismo: empalma el mensaje

Tu misión, si decides aceptarla, es descifrar el siguiente mensaje ultra secreto. Primero, elimina las letras "basura", de color púrpura y subrayadas. Después, coloca las letras restantes en grupos de tres desde el comienzo.
UNA VEZ F\maroonD{\textbf{UNA VEZ F}}AM APQ\purpleC{\underline{\text{AM APQ}}} UIC ONL\maroonD{\textbf{ UIC ONL}} ZAP TQM \purpleC{\underline{\text{ ZAP TQM }}}OSD OS\maroonD{\textbf{OSD OS}}
¿Ya lo intentaste?
  • Si eliminas las secuencias púrpura, deberías obtener esta serie de letras:
    UNAVEZF\maroonD{\textbf{UNAVEZF}}UICONL\maroonD{\textbf{UICONL}}OSDOS\maroonD{\textbf{OSDOS}}
  • Si agrupas las letras restantes en grupos de tres, deberías obtener este mensaje:
    UNA VEZ F\maroonD{\textbf{UNA VEZ F}}UI CON L\maroonD{\textbf{UI CON L}}OS DOS\maroonD{\textbf{OS DOS}}
    Bueno, tal vez no es el mensaje más ultrasecreto del mundo. ¡Espero que al menos haya sido entendible!
El proceso que acabas de realizar es básicamente lo que deben hacer tus células cuando expresan un gen. Como ya comentamos anteriormente en este artículo, la mayoría de los pre-ARNm eucariontes contienen secuencias "basura" llamadas intrones, que son como las letras púrpuras en el mensaje. Estas secuencias deben retirarse y las secuencias con significado (exones), equivalentes a las letras de color marrón en el mensaje anterior, deben volver a unirse para obtener un ARNm maduro.
Durante la traducción, la secuencia de ARNm se lee en grupos de tres nucleótidos. Cada "palabra" de tres letras corresponde a un aminoácido que se agrega a un polipéptido (proteína o subunidad de proteína). Si un ARN no se ha empalmado, este contendrá nucleótidos adicionales que no debería y producirá un "mensaje" de proteína erróneo. Algo similar ocurre si intentamos descifrar el mensaje anterior sin quitar las letras púrpuras:
UNA VEZ F\maroonD{\textbf{UNA VEZ F}}AM APQ\purpleC{\underline{\text{AM APQ}}} UIC ONL\maroonD{\textbf{ UIC ONL}} ZAP TQM \purpleC{\underline{\text{ ZAP TQM }}}OSD OS\maroonD{\textbf{OSD OS}}
Así como el eliminar las letras púrpuras de la oración es clave para encontrar el mensaje correcto, el empalme es clave para asegurar que un ARNm lleve la información correcta (y dirija la producción del polipéptido correcto).
Aquí está la secuencia de pre-ARNm, con los exones en color marrón y negritas, y un intrón con letras subrayadas y en color púrpura:
5’-...AUGCACUAU\text{5'-...}\maroonD{\textbf{AUGCACUAU}}GUAUGUGCCUUUUUGUGCUGUG\purpleC{\underline{\text{GUAUGUGCCUUUUUGUGCUGUG}}}GAAGCGUAA...-3’\maroonD{\textbf{GAAGCGUAA}}\text{...-3'}
Si el pre-ARNm se empalma correctamente, los nucleótidos del ARNm maduro se leen en grupos de tres y se obtiene el polipéptido que se muestra a continuación:
5’-...AUG CAC UAU \text{5'-...}\maroonD{\textbf{AUG CAC UAU }}GAA GCG UAA...-3’\maroonD{\textbf{GAA GCG UAA}}\text{...-3'}
Met - His - Tyr - Glu - Ala - ALTO\text{Met - His - Tyr - Glu - Ala - ALTO}
Si no se retira el intrón del pre-ARNm, el ARNm anormal resultante contiene nucleótidos adicionales. Cuando se leen sus nucleótidos en grupos de tres, como se muestra a continuación, se produce un polipéptido con una secuencia de aminoácidos incorrecta. Hay demasiados aminoácidos, y no se producen los aminoácidos codificados por el segundo exón (porque se desplaza el marco de lectura):
5’-...AUG CAC UAU \text{5'-...}\maroonD{\textbf{AUG CAC UAU }}GUA UGU GCC UUU UUG UGC UGU G\purpleC{\underline{\text{GUA UGU GCC UUU UUG UGC UGU G}}}GA AGC GUA A...-3’\maroonD{\textbf{GA AGC GUA A}}\text{...-3'}
Met - His - Tyr - Val - Cys - Ala - Phe - Leu - Cys - Cys - Gly - Ser - Val ...\text{Met - His - Tyr - Val - Cys - Ala - Phe - Leu - Cys - Cys - Gly - Ser - Val ...}
Todas las relaciones anteriores entre los grupos de nucleótidos y los aminoácidos que codifican pueden conocerse consultando la tabla del código genético:
_Image credit: "The genetic code: Figure 3," by OpenStax College, Biology (CC BY 3.0)._
Secuencia del intrón modificada de Bourdin et al.4^4.
Este artículo está autorizado bajo una licencia CC BY-NC-SA 4.0.

Referencias citadas:

  1. Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V. y Jackson, R. B. (2011). Alteration of mRNA ends (Modificación de los extremos de un ARNm). En Campbell biology (10° ed., pág. 342-343). San Francisco, CA: Pearson.
  2. Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V. y Jackson, R. B. (2011). The functional and evolutionary importance of introns (La importancia funcional y evolutiva de los intrones). En Campbell biology (10° ed., pág. 344). San Francisco, CA: Pearson.
  3. Keren, H., Lev-Maor, G. y Ast, G. (2010). Alternative splicing and evolution: diversification, exon definition and function (El empalme alternativo y la evolución: diversificación, definición y función del exón). Nature Reviews Genetics, 11, 345-355. http://dx.doi.org/10.1038/nrg2776. Consultado en https://www.tau.ac.il/~gilast/PAPERS/nrg2776.pdf.
  4. Standage, D. (8 de abril de 2012). Why do eukaryotic organisms have introns in their DNA? [Answer] (¿Por qué los organismos eucariontes tienen intrones en su ADN? [Respuesta]) En Biology stack exchange. Consultado en http://biology.stackexchange.com/questions/1724/why-do-eukaryotic-organisms-have-introns-in-their-dna.
  5. Bourdin, C. M., Moignot, B., Wang, L., Murillo, L., Juchaux, M., Quinchard, S., Lapied, B., Guérineau, N. C., Dong, K. y Legros, C. (2013). Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity (La retención de un intrón en el ARNm que codifica la subunidad de anclaje de un canal de sodio modulado por voltaje modula la expresión del canal controlando su regulación y sensibilidad a fármacos) . PLoS ONE, 8(8), e67290. http://dx.doi.org/10.1371/journal.pone.0067290.

Referencias complementarias:

Corte del extremo 3' y poliadenilación. (2016). En Nobelprize.org. Consultado en http://www.nobelprize.org/educational/medicine/dna/a/splicing/splicing_endformation.html.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K. y Walter, P. (2002). Posttranscriptional controls (Controles postranscripcionales). En Molecular biology of the cell (4ta ed.). Nueva York, NY: Garland Science. Consultado en http://www.ncbi.nlm.nih.gov/books/NBK26890/.
Intron/introns. (2014). En Scitable. Consultado en http://www.nature.com/scitable/definition/intron-introns-67.
Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D. y Darnell, J. (2000). Processing of eukaryotic mRNA (Procesamiento del ARNm eucarionte). En Molecular cell biology (4ta ed., sección 11.2). Nueva York, NY: W. H. Freeman. Consultado en http://www.ncbi.nlm.nih.gov/books/NBK21563/.
Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D. y Darnell, J. (2000). Transcription termination (Terminación de la transcripción). En Molecular cell biology (4ta ed., sección 11.1). Nueva York, NY: W. H. Freeman. Consultado en http://www.ncbi.nlm.nih.gov/books/NBK21601/.
Polyadenylation. (Poliadenilación; 24 de enero de 2016). Consultado el 11 de febrero de 2016 en Wikipedia: https://en.wikipedia.org/wiki/Polyadenylation.
Raven, P. H., Johnson, G. B., Mason, K. A., Losos, J. B. y Singer, S. R. (2014). Genes and how they work (Los genes y cómo funcionan). En Biology (10° ed., AP ed., pp. 278-303). Nueva York, NY: McGraw-Hill.
Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V. y Jackson, R. B. (2011). Eukaryotic cells modify RNA after transcription (Las células eucariontes modifican el ARN después de la transcripción). En Campbell biology (10° ed., pág. 342-345). San Francisco, CA: Pearson.
Cargando